Этот тег предназначен для вопросов о сценариях, написанных для командной оболочки Bash. Сценарии оболочки с синтаксисом или другими ошибками, пожалуйста, проверьте их на https://shellcheck.net, прежде чем публиковать здесь. Вопросы об интерактивном использовании Bash, скорее всего, будут актуальны на Unix & Linux Stack Exchange или Super User, чем на Stack Overflow.

Подробнее про bash...

Прежде всего, извините, я изучаю bash и я новичок. Пожалуйста, найдите приведенный ниже сценарий. grep "error" /var/log/syslog | while read line do echo $line done Если я не ошибаюсь, приведенный выше скрипт выполнит поиск ключевого слова «ошибка» в /var/log/syslog и отправит его в цик...
3 Фев 2023 в 19:57
Привет, я делаю проект, в котором я должен написать калькулятор сценария bash, который позволяет выполнять несколько арифметических операций, а также в силу. Я сделал базовую часть, но мне сказали, что я должен сделать ее неинтерактивной, и мне просто интересно, как мне это сделать? Мой код был пр...
3 Фев 2023 в 19:24
Когда я пытаюсь добавить строку bash, содержащую пробелы с jq, будет сгенерировано сообщение об ошибке. Ошибка не возникает, если нет пробелов. код, вызывающий ошибку value="value with spaces" echo {} | jq ". +={"key":"'$value'"}" сообщение об ошибке jq: error: syntax error, unexpected $end, exp...
3 Фев 2023 в 18:31
У меня есть 100 000 файлов, которые я хочу повторить с помощью приведенной ниже команды sed: sed -s -i -e 's/[[:space:]].*//' -e '1 s/^/>/g' -e '3 s/|*//g' -e '3 s/^/>ref/g' -e '1h;2H;1,2d;4G' До сих пор я использовал цикл bash: for i in read_* ; do sed -s -i -e 's/[[:space:]].*//' -e '1 s/^/>/...
3 Фев 2023 в 18:16
Ломаю голову над результатами сортировки двух столбцов unix sort. Вот некоторые фиктивные данные в файле с именем test: A 2e-12 A 3e-14 A 1e-15 A 1.2e-13 B 1e-13 B 1e-14 C 4e-12 C 3e-12 Я хотел бы сначала отсортировать по столбцу 1, а затем по столбцу...
3 Фев 2023 в 17:24
У меня есть файл, который выглядит так: a 12345 b 3456 c 45678 И у меня есть массив строк bash: mylist=("a" "b") Что я хочу сделать, так это суммировать числа во втором столбце, но только для строк, где значение первого столбца (также известное как «a» или «b») присутствует в mylist. Мой ...
3 Фев 2023 в 17:06
Мне нужно удалить все файлы с именем шаблона:  2020*.js Внутри определенного каталога: server/db/migrations/ А потом показать, что было удалено: `| xargs`` Я пробую это: find . -name 'server/db/migrations/2020*.js' #-delete | xargs Но ничего не удаляется и ничего не показывает. Что я делаю не так?...
3 Фев 2023 в 15:10
#!/bin/bash TARGET_ENV="$1" shift commandid=$(aws ssm send-command \ --document-name "AWS-RunShellScript" \ --targets Key=tag:Name,Values=$TARGET_ENV \ --parameters '{"commands":["su -c \"./'$@'\" - ec2-user"]}' \ --query 'Command.CommandId' \ --output text) echo $commandid (ss...
3 Фев 2023 в 05:45
У меня есть большой файл yaml, содержащий несколько блоков объявлений, связанных с разными службами. Структура аналогична следующей (но повторяется для нескольких приложений): - name: commerce-api type: helm version: 0.0.5 Я хотел бы найти блок кода, содержащий commerce-api, и заменить значение...
3 Фев 2023 в 01:20
Я разговариваю с сервером, который ежедневно создает новый zip-файл, например: (data-1234.zip). Каждый день имя предыдущего почтового индекса удаляется и создается новый с увеличивающимся номером, например: (data-1235.zip). Сценарий будет запускаться спорадически в течение недели, но он находится ...
3 Фев 2023 в 00:29
Я пытаюсь просмотреть файлы в некоторых каталогах и выполнить действие над каждым файлом. Список каталогов определяется списком строк, хранящихся как переменная среды. LIST_OF_DIRECTORIES=каталог1 каталог2 каталог3 for dir in $LIST_OF_DIRECTORIES; do for file in $dir/* ; do echo $file done...
3 Фев 2023 в 00:16
У меня есть очень простой контейнер Docker, который запускает скрипт bash: # syntax=docker/dockerfile:1.4 FROM alpine:3 WORKDIR /app RUN apk add --no-cache \ curl bash sed uuidgen COPY demo.sh /app/demo.sh RUN chmod +x /app/*.sh CMD ["bash", "/app/demo.sh"] #!/bin/bash echo "Test 123.." sl...
2 Фев 2023 в 23:24
Я создал скрипт bash для запуска резервной копии моей контейнерной базы данных postgres. Этот скрипт называется «do-pg-backup.sh»: #! bin/bash db=$(docker container ls -q --filter name=mydbcontainer* --format "{{.Names}}") docker exec -it $db /etc/pg-backup/pg-backup.sh echo "done pg backup" Ес...
2 Фев 2023 в 23:06
newwpuser=$cpuser"_"$wpuser newwpdb=$cpuser"_"$wpdb wpdb=($(find . -name "wp-config.php" -print0 | xargs -0 -r grep -e "DB_NAME" | cut -d \' -f 4)) wpuser=($(find . -name "wp-config.php" -print0 | xargs -0 -r grep -e "DB_USER" | cut -d \' -f 4)) wpconfigchanges=($(find . -name wp-config.php -type f)...
2 Фев 2023 в 23:05
Я использую getopts и для параметров я хочу принимать только один тип письма, но его можно передавать несколько раз. Не могу понять, как это сделать, но это должно работать так, как ls -l, когда все ls -lllllll и ls -l -l -l -l -l возвращают одно и то же и выполняются только один раз. while getopts...
2 Фев 2023 в 22:26
Я пишу сценарий bash для чтения файла JSON и экспорта пар ключ-значение в качестве переменных среды. Хотя я мог извлечь пары ключ-значение, я изо всех сил пытаюсь пропустить те записи, которые не удалось проанализировать с помощью jq. JSON (key3 не должен анализироваться) { "KEY1":"ABC", "KEY2":"...
2 Фев 2023 в 22:23
В настоящее время я работаю над конвейером, в котором я использую некоторый бэкэнд, чтобы гарантировать, что мои формы терраформирования будут работать, но проблема, которая у меня есть, заключается в том, что я получаю следующую проблему: Too many command-line arguments. Did you mean to use -chdir...
2 Фев 2023 в 21:39
Я пытаюсь изучить bash, поэтому я работал над игрой типа «угадай число». Я пытаюсь генерировать случайные числа на основе ввода пользователя для нижних и верхних границ. Но некоторые тестовые случаи, кажется, создают числа, которые не имеют смысла; некоторые из них находятся за пределами моих гра...
2 Фев 2023 в 21:03
Я пытаюсь использовать API отдыха с токеном в заголовке. apikeyName="$(date '+%s')" key=$(curl -k -X POST -H "Content-Type: application/json" \ -d '{"name":"'$apikeyName'", "role": "Admin"}' \ http://admin:admin@localhost:3000/api/auth/keys | jq '.key') echo ...
2 Фев 2023 в 20:46
Привет, мой ввод выглядит так: >ref GGTGCCCACACTAATGATGTAAAACAATTAACAGAGGCAGTGCAAA >sample1 GGTGCCCACACTAATGATGTAAAACAATTAACAGAGGCAGTGCAAA >ref GGTTAGGGCCGCCTGTTGGTGGGCGGGAATCAAGCAGCATTTTGGAATTCCCTACAAT >sample2 GGTTAGGGCCGCCTGTTGGTGGGCGGGAATCAAGCAGGTATTTGGAATTCCCTACAAT Записи в файле fasta объ...
2 Фев 2023 в 20:11
У меня есть html-файл, который я обрабатываю с помощью скрипта bash и хочу удалить пустые таблицы. Файл создается из оператора sql, но содержит заголовок таблицы, если записи не найдены. Я хочу удалить заголовок, в котором нет записей. <table border="1"> <caption>Table with data</caption> <tr>...
2 Фев 2023 в 19:42
Я хочу использовать сразу несколько переменных в цикле for в sh. У меня такой запрос: top -n 1 -b -c| awk -vOFS="\t" '{print $1,$2,$9}' Я знаю, что использую цикл for в bash следующим образом: for i in {2..10} do echo "output: $i" done Что я хочу попробовать: for x y z in $(top -n 1 -b -c| awk...
2 Фев 2023 в 19:26
У меня есть несколько сотен файлов в следующем формате: Файл1: ########## ##TestB ########## y-81=9 Test B is for another test ** Few Thousands of lines** ########## ########## ##TestA ## ########## Test A is for testing correctiveness of the code x-10=92 ** Few thousands of lines*** ########### ##...
2 Фев 2023 в 19:19
Я пытаюсь написать функцию bash для проверки модулей в kuebernetes и проверки работоспособности всех модулей, т.е. они либо запущены, либо завершены, если нет, я вхожу в цикл и выхожу с ошибкой. check_pods_status() { # Save the output of the kubectl command in an array pods_status=`kubectl get p...
2 Фев 2023 в 18:52
В рамках школьного проекта мы должны написать упрощенную оболочку и получить указание имитировать поведение Bash. Пытаясь понять, как заставить упрощенную оболочку работать в неинтерактивном режиме, я заметил 2 проблемы: readline выводит ввод на стандартный вывод, независимо от того, подключены ли ...
2 Фев 2023 в 16:55