Часть строки или функция / метод, которая возвращает часть строки

Подробнее про substring...

Я пытаюсь повторно реализовать алгоритм для создания списка уточненных ключевых слов. У меня нет оригинального исходного кода, только файл .exe инструмента, поэтому у меня есть только ввод и ожидаемый вывод. Проблема здесь в том, что вывод моей функции не совпадает с выводом оригинальной. Вот код,....
3 Фев 2022 в 22:26
Я очищаю набор данных с помощью символьной переменной следующим образом: df <- c("2015 000808", "2013 000041", "2015 000005", "2015 301585", "2015 311585", "2014 380096", "2013 100041") Таким образом, я могу добиться этого результата, когда 000 перед вторым числом удаляются, а каждое число с....
30 Янв 2022 в 20:48
Надеюсь, у вас все хорошо. Я работал над упражнением на С++ и нашел решение немного странным (для себя-новичка). Цель состоит в том, чтобы получить инициалы имени, отчества и фамилии, за которыми следует точка. string first; string middle string last; string result; Выражение вводится в строку рез....
30 Янв 2022 в 09:26
Действительно основной вопрос, но я не мог найти способ правильно этого добиться. У меня есть два списка: vowels = ['a', 'e', 'i', 'o', 'u'] А также usernames = ['example1', 'zzzzz23', 'eeeee43', 'llllll5', 'pppapp1', 'wwsd0'] Я хочу извлечь из usernames все элементы, в которых нет vowels. Я стара....
29 Янв 2022 в 21:08
Я пытаюсь написать метод в java для запуска случаев введенной пользователем строки. Код: static String checkWMI(String userVIN){ String manCountry = null; String WMI = userVIN.substring(0, 5); String Wcheck = WMI.substring(WMI.length()- 4); if(Wcheck.equals("1") || Wcheck.equals("....
26 Янв 2022 в 13:08
Я пытаюсь удалить некоторые символы из строк, но мой код почему-то не работает. У меня есть следующие данные data <- as.data.frame (structure(list(col_name = c("applexz", "Jack", "Tablesxz", "aorange")))) col_name applexz Jack Tablexz aorange И я пытаюсь сказать R удалить последние два си....
25 Янв 2022 в 18:51
В соответствии с этим ответом (Найти все возможные подстроки самым быстрым способом). Самый быстрый способ найти все возможные подстроки строки — это O(N^2). Однако это все еще верно, если, скажем, у меня есть список слов, и я не хочу видеть, есть ли у определенной строки x подстроки, которые нахо....
25 Янв 2022 в 05:05
У меня есть три столбца в моей базе данных ID | boundary_coord | lat | lng | ------------------------------------------------------------ 1 | [[27.913308738086336,78.0780080756358], | | | | [21.913355835273993,75.07837828047921], | | | | [26.9136056473....
24 Янв 2022 в 14:20
Мне нужно отфильтровать мой плоский ассоциативный массив значений строкового типа, проверив, найден ли его ключ (с учетом регистра) в его значении в виде подстроки. Другими словами, если ключ элемента находится в значении элемента, я хочу сохранить элемент в выходном массиве. Я могу создать классич....
23 Янв 2022 в 10:30
Мы отслеживаем внутреннюю сущность с UUID, сгенерированным java.util. Новым требованием является передача этого объекта третьей стороне, которой требуется уникальный идентификатор с максимальным ограничением в 11 символов. Вместо создания, отслеживания и сопоставления совершенно нового уникального ....
20 Янв 2022 в 19:07
Я не эксперт в python, и, поскольку это связано с работой, мне, возможно, придется изменить некоторые переменные и информацию. Итак, у меня есть длинная строка из запроса API, в котором я ищу информацию о пользователях, и чтобы убедиться, что у меня есть только информация о пользователях, я использу....
20 Янв 2022 в 17:54
Вопрос: У меня есть 2 файла, файл 1 - это файл TSV (BED), который имеет 23 последовательности пар оснований в столбце 7, например: 1 779692 779715 Sample_3 + 1 ATGGTGCTTTGTTATGGCAGCTC 1 783462 783485 Sample_4 - 1 ATGAATAAGTCAAGTAAATGGAC Файл 2 — это файл FASTA (hg19.fasta), который выглядит сле....
19 Янв 2022 в 18:13
У меня есть эта строка ffff @fgggg @, как я могу сделать последнюю подстроку @, это означает, что когда я использую этот код: String text = `ffff @fgggg @`; selectedUser = text.substring(); Я ожидаю, что selectedUser будет == ""; Я хочу проверить текст с последнего @ ? Если после последнего @ нич....
18 Янв 2022 в 00:39
Моя строка выглядит так street no [12] Мне нужно извлечь только 12 из строки. Как получить подстроку между двумя [ ] в javascript или jquery? Найти подстроку между первыми совпадающими скобками []....
17 Янв 2022 в 17:46
Учитывая строку, как показано ниже, "[xyx],[abc].[cfd],[abc].[dgr],[abc]" Как распечатать его, как показано ниже? 1.[xyz] 2.[cfd] 3.[dgr] Исходная строка всегда будет поддерживать вышеупомянутый формат.....
16 Янв 2022 в 22:31
Я запускаю команду в терминале Windows: PS E:\> netsh wlan show profile name="wifi_profile" key=clear | findstr "Key Content" Key Content : password1234 Итак, здесь я пытаюсь получить только password123 (пароль Wi-Fi) на выходе для любого профиля. Есть ли способ в powershell, с помощ....
15 Янв 2022 в 10:05
У меня проблема с умножением положительного числа на отрицательное из строкового выражения. Если мое выражение равно -4*5, оно возвращает -20, но если я помещаю 4*-5, оно возвращает -5 вместо -20. Я провел небольшую отладку и обнаружил, что моя подстрока принимает только -5, но после оператора * не ....
14 Янв 2022 в 10:50
Я хотел бы узнать, содержит ли ячейка подстроку foo и только эту строку (ничего до, ничего после) в ряду ячеек, которые могут содержать foobar. В настоящее время я использую regexp в MATLAB и хотел бы настроить искомый шаблон regexp, чтобы исключить ячейки, содержащие строку, содержащую определенную....
13 Янв 2022 в 18:34
Я пытаюсь добавить некоторые числа из строки. Например, строка «5 + 3 + 2». Это должно вернуть 10. Это мой код для получения номера оператора "+" int opIndex= expression.indexOf("+"); Double lhs = Double.parseDouble(expression.substring(0, opIndex)); Double rhs = Double.pars....
13 Янв 2022 в 14:32
Существует список строк, которые являются выходными данными пиринга vnet. Мне нужно извлечь все имена исходных виртуальных сетей в один список и имена целевых виртуальных сетей в другой список. Мои имена пиринга vnet, как показано ниже Peer =["vnet1tovnet2", "vnet1tovnet3", "vnet4tov....
13 Янв 2022 в 04:19
У меня есть некоторые проблемы с адаптацией ответов на предыдущие вопросы, поэтому я надеюсь, что можно написать для конкретного решения. У меня есть файл с РНК-чтениями в формате fasta, однако конец имени перепутан, поэтому мне нужно его исправить. Это простая задача добавления нулей в середину стр....
12 Янв 2022 в 13:49
У меня есть набор данных sas с переменной под названием response, которая имеет следующие записи: И так далее. Это все одинаковые записи, мне нужно убрать последний символ везде где спец и вернуть записи как Когда я использую функцию сжатия, она удаляет звездочку между ними и возвращает: TrailerOf....
12 Янв 2022 в 11:12
У меня есть скрипт, который пытается найти наличие заданной строки внутри файла произвольного текста. Я остановился на чем-то вроде: #!/bin/bash file="myfile.txt" for j in `cat blacklist.txt`; do echo Searching for $j... unset match match=`grep -i -m1 -o "$j" $file` if [ $match ]; then e....
12 Янв 2022 в 05:26
У меня есть список my_list=['Hello jose','jjjj','jack signal','jjjjjj'] Я старался [i.replace('j','') for i in my_list] Мой вывод: ['hello ose', '', 'ackpot', ''] Мой ожидаемый результат: ['Hello jose','','jackpot',''] Как удалить подстроку «j», если она повторяется рядом с другой?....
10 Янв 2022 в 02:28
У меня есть следующий фрейм данных: df = data.frame(column1=c("abc", "def", "ghi"), column2=c("jki", "lmn", "opq"), column3=c("A-", "B-C", NA)) И я хочу установить значение ячейки column3 на NA, если ячейка заканчивается на -. Мне удалось только разделить фрейм данных, чего я не хочу: subset(df, !g....
5 Янв 2022 в 14:36